, printed on 12/22/2024
The following probe set reference and supporting files are available on the Cell Ranger downloads page:
| File | Description |
|---|---|
| Probe set reference CSV file | This CSV file is a required input for Cell Ranger to enable analysis of Single Cell Fixed RNA Profiling data. It specifies the probe sequences used for probe alignment. |
| Probe off-target activity CSV | A CSV file that lists probes with predicted off-target activity, excluded from analysis by default. |
| Probe set BED file | A BED12 file that contains the sequences and genomic coordinates of the probes. This file can be used to visualize the probe locations in a genome browser and intersect probe locations with other data sources. |
| Probe set metadata TSV file | A TSV file that lists probes with additional information about gene name and description. |
| Probe Barcode sequence TXT file | A text file with the sequences of the Probe Barcodes. This file is available in the Cell Ranger software tarball and on the Cell Ranger downloads page. |
Files containing information about individual probes have a column corresponding to the probe identifier (ID) that uniquely identifies each probe. Probe IDs take the following format:
gene_id|gene_name|probe_sequence_hash
For example, the probe for the gene TSPAN6 in the human whole transcriptome probe set, which has the Ensembl gene ID ENSG00000000003 in the GRCh38-2020-A reference, has the probe ID ENSG00000000003|TSPAN6|41ef80c.
A small number of probes whose ID includes the prefix DEPRECATED are excluded from analysis by default.
This CSV file is a required input for Cell Ranger to enable analysis of Fixed RNA Profiling data. It specifies the sequences used as a reference for probe alignment and the gene ID associated with each probe. See a description of the probe-set argument in the cellranger multi documentation. This file is provided in the Cell Ranger tarball.
The following snippet is an example from a v1.0 probe set reference CSV file:
#probe_set_file_format=1.0 #panel_name=Chromium Human Transcriptome Probe Set #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included ENSG00000000003,GGTGA[...]ATGGC,ENSG00000000003|TSPAN6|8eab823,TRUE ENSG00000000003,TCTGC[...]TTAGG,ENSG00000000003|TSPAN6|9d7fe51,TRUE [ ... ]
The v1.0.1 probe set has a new region column, which indicates whether a probe spans a splice junction by at least 10 bp (spliced) or not (unspliced).
#probe_set_file_format=2.0 #panel_name=Chromium Human Transcriptome Probe Set v1.0.1 #panel_type=predesigned #reference_genome=GRCh38 #reference_version=2020-A gene_id,probe_seq,probe_id,included,region ENSG00000000003,GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC,ENSG00000000003|TSPAN6|8eab823,TRUE,spliced ENSG00000000003,TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG,ENSG00000000003|TSPAN6|9d7fe51,TRUE,unspliced [ ... ]
The columns of this file are:
| Column Name | Description |
|---|---|
gene_id |
The Ensembl gene identifier targeted by the probe. |
probe_seq |
The nucleotide sequence of the probe, which is complementary to the transcript sequence. |
probe_id |
The probe identifier, whose format is described in Probe identifiers. |
included |
A TRUE/FALSE flag specifying whether the probe is included in the filtered counts matrix output or excluded by the probe filter. See filter-probes option of cellranger multi. All probes of a gene must be marked TRUE in the included column for that gene to be included. |
region |
Present only in v1.0.1 probe set reference CSV. The gene boundary targeted by the probe. Accepted values are spliced or unspliced. |
The file also contains a number of required metadata fields in the header in the format #key=value:
| Metadata Field | Description |
|---|---|
panel_name |
The name of the probe set. |
panel_type |
Always predesigned for predesigned probe sets. |
reference_genome |
The reference genome build used for probe design. |
reference_version |
The version of the Cell Ranger reference transcriptome used for probe design. |
probe_set_file_format |
The version of the probe set file format specification that this file conforms to. |
This CSV file lists probes with predicted off-target activity identified by alignment to the reference transcriptome.
The following snippet is an example of a probe off-target activity CSV file:
probe_id,off_target_genes ENSG00000004478|FKBP4|ed8be23,ENSG00000235256|FKBP4P7;ENSG00000251463|FKBP4P1;ENSG00000268234|FKBP4P6;ENSG00000269692|FKBP4P2;ENSG00000276457|FKBP4P8 ENSG00000005302|MSL3|46ea040,ENSG00000224287|MSL3P1;ENSG00000239254|AC009220.2 ENSG00000006015|REX1BD|8367ca6,ENSG00000130766|SESN2 ENSG00000011009|LYPLA2|f905390,ENSG00000228285|LYPLA2P1;ENSG00000236604|LYPLA2P3;ENSG00000269153|LYPLA2P2 ENSG00000029363|BCLAF1|4400f06,ENSG00000248966|BCLAF1P1 ENSG00000048545|GUCA1A|42f457b,ENSG00000287363|AL096814.2 ENSG00000051596|THOC3|2d7334d,ENSG00000170089|AC106795.1 ENSG00000055955|ITIH4|e3e9693,ENSG00000243696|AC006254.1 [ ... ]
The columns for this file are:
| Column Name | Description |
|---|---|
probe_id |
The ID of the probe with predicted off-target activity. |
off_target_genes |
A semicolon-separated list of predicted off-target genes. For each off-target gene, the Ensembl gene ID and gene symbol are separated by a vertical bar. |
A BED12-formatted file that contains the sequences and genomic coordinates of the probes. This file may be used to visualize the probe locations with genome browsers like IGV (Integrated Genomics Viewer) and the UCSC Genome Browser or to intersect the probe locations with other genomic features of interest using tools like bedtools.
The following snippet is from an example BED12 file:
chr1 69485 69535 ENSG00000186092|OR4F5|118842c 0 - 69485 69535 0 1 50 0 chr1 926007 930198 ENSG00000187634|SAMD11|ce0f9f1 0 - 926007 930198 0 2 6,44 0,4147 chr1 930204 930254 ENSG00000187634|SAMD11|03fbb84 0 - 930204 930254 0 1 50 0 chr1 942810 942860 ENSG00000187634|SAMD11|fbf73f3 0 - 942810 942855 0 1 50 0 chr1 958990 959040 ENSG00000188976|NOC2L|e191323 0 + 958990 959040 0 1 50 0 chr1 952099 952421 ENSG00000188976|NOC2L|95b770b 0 + 952099 952421 0 2 40,10 0,312 chr1 944599 944649 ENSG00000188976|NOC2L|199f6ec 0 + 0 0 0 1 50 0 chr1 962784 962834 ENSG00000187961|KLHL17|f5213de 0 - 962784 962834 0 1 50 0 chr1 963238 963371 ENSG00000187961|KLHL17|82b4408 0 - 963238 963371 0 2 15,35 0,98 chr1 963416 963466 ENSG00000187961|KLHL17|f9ac954 0 - 963416 963466 0 1 50 0 chr1 966584 966723 ENSG00000187583|PLEKHN1|665a14d 0 - 966584 966723 0 2 30,20 0,119 [...]
The columns of BED12 files we provide are as follows (adapted from UCSC Genome Browser documentation):
| Column Name | Description |
|---|---|
chromosome |
Chromosome of the target gene. |
chromStart |
0-based start coordinate of the targeted sequence on the chromosome. |
chromEnd |
0-based non-inclusive end coordinate on the chromosome. |
name |
Probe ID as described above. |
score |
Set to 0 for all entries. |
strand |
+ or - to indicate the strand of the targeted gene. |
thickStart |
The starting position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region). |
thickEnd |
The ending position at which the feature is drawn as a thick line in browsers (matches display of the corresponding transcript region). |
itemRgb |
Set to 0 for all entries. |
blockCount |
The number of blocks (continuous intervals). |
blockSizes |
Comma-separated list of the block sizes, contains blockCount entries. |
blockStarts |
Comma-separated list of block starts relative to chromStart column, contains blockCount entries. |
The BED12 format was chosen because it allows probes that span splice junctions to be conveniently represented on a single line and allows genome browsers to visualize links between regions of probes that are discontinuous in genomic space. Browsers such as UCSC Genome Browser or IGV will render BED12 files appropriately, similar to how transcripts in the genome are displayed.
This format is also well-supported by command-line tools. For example, bedtools provides a -split command-line flag for some subcommands to allow the individual blocks within each line of a BED12 file to be treated independently as needed. This can be useful for calculating intersections, for example, where you may be interested in intersections with the regions covered by the probes themselves rather than intersections with the entire genomic interval the probe coordinates span including intronic regions. bedtools also provides the subcommand bed12tobed6 for conversion of BED12 files to BED6 format -- in the resulting file each probe would appear on multiple lines when spanning one or more splice junctions.
This TSV file lists additional metadata information on gene name and description for the genes targeted by probes. The file contains all the columns from Probe set reference CSV file, as well as information about probe coverage for targeted genes and the transcript ID targeted by the probe. This file does not list the DEPRECATED probes.
The following is a snippet from the human probe metadata TSV file:
probe_id gene_id gene_name gene_description probe_seq included gene_total_coverage_rounds coverage_round transcript_id_set region ENSG00000000003|TSPAN6|8eab823 ENSG00000000003 TSPAN6 tetraspanin 6 GGTGACACCACAACAATGCAACGTATTTTGGATCTTGTCTACTGCATGGC TRUE 3 1 ENST00000373020;ENST00000612152;ENST00000614008 spliced ENSG00000000003|TSPAN6|9d7fe51 ENSG00000000003 TSPAN6 tetraspanin 6 TCTGCATCTCTCTGTGGAGTACAATCTTCAAGTTTACAGCAACTCTTAGG TRUE 3 2 ENST00000373020;ENST00000612152;ENST00000614008 unspliced [...]
The columns of this file in order are:
| Column name | Description |
|---|---|
probe_id |
Probe ID, same as in probe set file |
gene_id |
Gene ID from the probe ID, same as in probe set file |
gene_name |
Gene name from the probe ID (e.g. ACTA1), same as in probe set file |
gene_description |
Long-form gene description from Ensembl (e.g. actin alpha 1, skeletal muscle) |
probe_seq |
Templated portion of probe pair sequence, same as in probe set file |
included |
Included column from probe set file |
gene_total_coverage_rounds |
The total number of coverage rounds that are present for this gene (fold-coverage of all transcripts for that gene within the panel) |
coverage_round |
1, 2, or 3 – The round of coverage to which the probe belongs. Counts from probes belonging to the same coverage round must be added together to get the full gene-level count for that round of coverage. gene_total_coverage_rounds is the max of this column within the gene to which this probe is designed. |
transcript_id_set |
Semicolon-separated list of the set of transcripts that this particular probe was designed to cover. There may be transcripts outside of GENCODE basic that are covered but not listed here. Ensembl transcript IDs are used. |
region |
Corresponds to the region column of the probe set reference CSV (only in v1.0.1 reference CSV). The gene boundary targeted by the probe. Accepted values are spliced or unspliced. |
The Probe Barcode sequences are included as a text file in the Cell Ranger software tarball (i.e., cellranger-7.0.0/lib/python/cellranger/barcodes/translation/probe-barcodes-fixed-rna-profiling.txt) and on the Cell Ranger downloads page.
Each Probe Barcode ID (e.g., BC001) has a total of eight sequences. To ensure balanced base composition during sequencing, each ID has a distinct mixture of four sequences (first four sequences listed in the text file for each ID). The remaining four sequences for each ID are included to account for potential base deletion in bases 1-68 on the R2 read during sequencing.
The first column is the actual sequence of the Probe Barcode, the second column is the sequence after translation in Cell Ranger analysis (only applies to multiplex workflows), and the third column is the Probe Barcode ID. The following snippet shows the eight sequences associated with BC001 and with BC002:
ACTTTAGG ACTTTAGG BC001 CTTTAGGC ACTTTAGG BC001 CGAGGGTA ACTTTAGG BC001 GAGGGTAC ACTTTAGG BC001 GACACTAC ACTTTAGG BC001 ACACTACC ACTTTAGG BC001 TTGCACCT ACTTTAGG BC001 TGCACCTC ACTTTAGG BC001 AACGGGAA AACGGGAA BC002 ACGGGAAC AACGGGAA BC002 CGAATTGC AACGGGAA BC002 GAATTGCC AACGGGAA BC002 GTTCCATT AACGGGAA BC002 TTCCATTC AACGGGAA BC002 TCGTACCG AACGGGAA BC002 CGTACCGC AACGGGAA BC002 ...